logo dopfo.ru DOPFO.RU | Личный кабинет | Контакты | Доставка товара

Аксессуар Защитное стекло Mobius для Nokia 8.1 3D Full Cover Black 4232-254


Артикул № 631478

510 РУБ

Mobius 4232-254 похожие

Подробнее

Кастрюля 1.5 л Kelli KL-4232

Аксессуар Rexant 3.5mm Stereo Plug - 2RCA 1.5m 17-4232


Артикул № 375650

392 РУБ

Rexant 17-4232 похожие

Подробнее

Электрическая варочная панель GEFEST ЭС В СН 4232 К12

Аксессуар Защитное стекло Mobius для Huawei P30 Lite 3D Full Cover Black 4232-273


Артикул № 650263

510 РУБ

Mobius 4232-273 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Nokia 7.1 3D Full Cover Black 4232-252


Артикул № 631475

459 РУБ

Mobius 4232-252 похожие

Подробнее

Аксессуар Защитное стекло Mobius 3D Full Cover для Samsung Galaxy J2 Core Black 4232-233


Артикул № 631483

459 РУБ

Mobius 4232-233 похожие

Подробнее

Аксессуар Защитное стекло Mobius 3D Full Cover для Samsung Galaxy J4 Plus 2018 Black 4232-215


Артикул № 608855

459 РУБ

Mobius 4232-215 похожие

Подробнее

Аксессуар Защитное стекло для APPLE Watch 4 44mm Mobius 3D Full Cover 4232-229


Артикул № 626621

650 РУБ

Mobius 4232-229 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Honor 8C 3D Full Cover Black 4232-230


Артикул № 626627

459 РУБ

Mobius 4232-230 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Xiaomi Black Shark 2 3D Full Cover 4232-280


Артикул № 650250

510 РУБ

Mobius 4232-280 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Huawei P30 3D Full Cover Black 4232-272


Артикул № 650264

510 РУБ

Mobius 4232-272 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Sony Xperia XZ2 Compact 3D Full Cover Black 4232-242


Артикул № 631486

510 РУБ

Mobius 4232-242 похожие

Подробнее

Аксессуар Защитное стекло Mobius 3D Full Cover для Samsung Galaxy J6 Plus 2018 Black 4232-216


Артикул № 608856

369 РУБ

Mobius 4232-216 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Huawei Mate 20 Lite 3D Full Cover Black 4232-217


Артикул № 608861

459 РУБ

Mobius 4232-217 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Honor P20 Pro 3D Full Cover Black 4232-167


Артикул № 553754

520 РУБ

Mobius 4232-167 похожие

Подробнее

Аксессуар Защитное стекло Mobius для OnePlus 6T 3D Full Cover Black 4232-231


Артикул № 626626

459 РУБ

Mobius 4232-231 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Xiaomi Mi Play 3D Full Cover Black 4232-255


Артикул № 650247

510 РУБ

Mobius 4232-255 похожие

Подробнее

Table S1.1, XLSX file, 2 MB - mBio

2541, s18526, CGGCAGACCAGGUUAUUGAtt, 9637, NM_001042548 ...... 3443, s19418, GCAUCUUUCUGACGACGGAtt, 9993, NM_005137, DGCR2, 0.58, 80.86 ...... 4232, s226018, CCAUGGAAGGACUUCGGAAtt, 254910, NM_178438 ...

Cb xl 002 20 светильник бали 2 20см 3 цвета - …

Новое. набор для завтрака osz принцессы 3 предмета; набор чашек для супа с блюдц 6шт 0 30л форма сабина 0979 фарфор leander 655512

Sheet1 - mBio

28 Jul 2015 ... 2541, s18526, CGGCAGACCAGGUUAUUGAtt, 9637, NM_001042548 ...... 3443, s19418, GCAUCUUUCUGACGACGGAtt, 9993, NM_005137, DGCR2, 0.58, 80.86 ...... 4232, s226018, CCAUGGAAGGACUUCGGAAtt, 254910 ...

Каталог - Книги для школы - domkniginn.ru

Алгебра. 9 класс. Методическое пособие. Углубленный уровень. ФГОС. Буцко Елена Владимировна, Мерзляк Аркадий Григорьевич, Полонский Виталий …

Саванна Azori: купить плитку саванна по …

Приобретая плитку Саванна Azori Россия Вы получаете керамику высокого качества. Купить плитку Саванна Azori от официального производителя со скидками.

Лучшие решатели - grandgames.net

В этом рейтинге на лидирующих позициях игроки, которые регулярно решают большое количество головоломок различных видов. Очки считаются как сумма (максимальное место в …

Женское платье без рукавов S19418(4232-2541) …

Женское платье без рукавов s19418(4232-2541), материал плательная ткань, страна Россия, цена 4290.00 руб. Лето - прекрасное время для обновления …

4232 254. Лучшие решатели - grandgames.net

В этом рейтинге на лидирующих позициях игроки, которые регулярно решают большое количество головоломок различных видов. Очки считаются как сумма (максимальное место в …

Lacy 8 • Платье без рукавов • Совместные покупки SuperPuper

... см Размер - 50 Обхват груди - 99 ± 1 см Обхват талии - 78 ± 1 см Обхват бёдер - 105 ± 1 см 95% полиэстер 5% эластан. Артикул: S19418(4232-2541).

[Current] Число - Страница 2 - GMNET.RU …

02.10.2007 · Страница 2- [Current] Число Болталка ... 3999 4000 4001 4002 4003 4004 4005 4006 4007 4008 4009 4010 4011 4012 4013 4014 4015 4016

Женское платье без рукавов S19418(4232-2541) - купить в ...

Женское платье без рукавов S19418(4232-2541), материал плательная ткань, страна Россия, цена 4290.00 руб. Лето - прекрасное время для ...

Весна-Лето - купить в интернет-магазине одежды Lacywear.ru в ...

Летний сарафан S15618(4268-2541). Летний сарафан ..... Юбка U171502( 2590+2541). Юбка ... Платье без рукавов S19418(4232-2541). Платье без ...

95 003 светильник краски индонезии кокос о …

Наименование товара: 95-003 Светильник Краски Индонезии (кокос, о. Бали) Модель: модель не указана

Новости мира - главный новостной портал …

Vor 1 Tag · Национальный банк Украины усилил безопасность помещений украинских банков Национальный банк Украины принял решение усилить охрану помещений украинских банков.

***394 respresentative Yeast DNA-BPs*** >SGD|S000000966 ...

... ProteinModelPortal:P31380 DIP:DIP-2541N IntAct:P31380 MINT:MINT-425278 STRING:4932. .... SMR:P53050 DIP:DIP-4232N MINT:MINT-510395 STRING: 4932. ...... GeneTree:ENSGT00390000000033 PIR:S19418 RefSeq:NP_010031. 1 ...

38 005панно дельфин мал ... - kingfoto.ru

Поиск и заказы онлайн - 38 005панно дельфин мал мозаика о бали

Премиум - купить в интернет-магазине одежды Lacywear.ru в ...

Купить Премиум недорого в интернет-магазине Lacywear.ru в Москве. Детская, мужская и женская одежда по низким ценам! Скидки!

Платья на подкладках в Новосибирске - 4065 товаров: Выгодные ...

Платье без рукавов LacyWear S19418(4232-2541) Быстрый просмотр. Платье без рукавов LacyWear S19418(4232-2541). Доставка: Новосибирск.

Array Design Name Agilent-029564 LBLGC-Ptrichocarpa (Probe ...

... S19418 unmapped GGTGATTTTGCAGCTAACTTGAGGCTTTTACAGCACTATCCTGACATCAACATTGAACAC ...... S2541 unmapped ...... S4232 unmapped ...

Аксессуар Защитное стекло Mobius для Sony Xperia 10 Plus 3D Full Cover Black 4232-269


Артикул № 650257

510 РУБ

Mobius 4232-269 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Huawei Nova 4 3D Full Cover Black 4232-256


Артикул № 650265

510 РУБ

Mobius 4232-256 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Huawei Mate 20 3D Full Cover Black 4232-221


Артикул № 616469

459 РУБ

Mobius 4232-221 похожие

Подробнее

Аксессуар Защитное стекло для Samsung Galaxy A9 2018 Mobius 3D Full Cover Black 4232-220


Артикул № 616465

510 РУБ

Mobius 4232-220 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Honor P20 3D Full Cover Black 4232-165


Артикул № 553756

511 РУБ

Mobius 4232-165 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Xiaomi Mi Mix 3 3D Full Cover Black 4232-232


Артикул № 626628

459 РУБ

Mobius 4232-232 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Sony Xperia XA2 Ultra 3D Full Cover Black 4232-240


Артикул № 650254

510 РУБ

Mobius 4232-240 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Huawei Y7 2019 3D Full Cover Black 4232-267


Артикул № 650262

510 РУБ

Mobius 4232-267 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Honor 8X Max 3D Full Cover Black 4232-258


Артикул № 650268

510 РУБ

Mobius 4232-258 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Nokia 2.1 3D Full Cover Black 4232-245


Артикул № 631466

510 РУБ

Mobius 4232-245 похожие

Подробнее

Аксессуар Защитное стекло Mobius 3D Full Cover для Samsung Galaxy J8 2018 Black 4232-193


Артикул № 585842

517 РУБ

Mobius 4232-193 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Xiaomi Redmi 6 Pro 3D Full Cover Black 4232-199


Артикул № 594627

510 РУБ

Mobius 4232-199 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Honor Play 3D Fill Cover Black 4232-203


Артикул № 596882

159 РУБ

Mobius 4232-203 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Xiaomi Redmi Go 3D Full Cover Black 4232-263


Артикул № 650245

510 РУБ

Mobius 4232-263 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Honor 10 Lite/P Smart 2019 3D Full Cover Black 4232-257


Артикул № 650271

510 РУБ

Mobius 4232-257 похожие

Подробнее

Аксессуар Защитное стекло Mobius для Nokia 3.1 3D Full Cover Black 4232-246


Артикул № 631468

459 РУБ

Mobius 4232-246 похожие

Подробнее

TG-4232 Статуэтка Улитка Антон бол. (Томас Хоффман)


TG-4232 Статуэтка Улитка Антон бол. (Томас Хоффман)

37310 РУБ

TOMS Drag похожие

Подробнее

Аксессуар Защитное стекло Mobius для Xiaomi Redmi 6 / 6A 3D Full Cover Black 4232-197


Артикул № 585841

511 РУБ

Mobius 4232-197 похожие

Подробнее

Комментарии


#4232 254 #38833 11 #turbocharger cartridge for citroen c5 750030 gt1544v 753420 753420 5005s turbo #2 5 inch hid bi xenon fog lights metal projector lens driving lamp retrofit car #linda merrill small animal internal medicine for veterinary technicians and #cs 333 bk #jdb 152120 152125 152130 graphite lubricating brass bearing bushing sleeve #awi wv 58 #70890 #r coop l veterinary parasitology #tool set автоdело professional 39891 90пр 1 2 dr 1 4 6pt #cs tk540c #диван угловой мебелико гранд эко кожа белый левый #gt1544v 753420 turbocharger turbo chra cartridge core for peugeot 308 turbine #кольцо из золота 53022 #lowell ackerman blackwells five minute veterinary practice management consult #flo c028wl l6w #u201a #гирлянда эл звездочки 100 мини ламп quot рис quot цветное свечение 8 реж #4166 1w #jigu original laptop battery 45n1702 45n1703 for lenovo for thinkpad x1 carbon #kara burns textbook for the veterinary assistant #70638 #аксессуар защитное стекло mobius для honor p20 3d full cover black 4232 165 #mp 21030 #awc rs 10m #heidi b lobprise wiggss veterinary dentistry principles and practice #духовой шкаф whirlpool akp 807 ix #turbocharger cartridge core chra kp35 54359700011 54359710012 54359700012 #rha ma750i #peter economy consulting for dummies #леггинсы для девочки sweet berry #розетка ethernet rj 45 без рамки werkel слоновая кость wl03 rj 45 ivory #насосы #миксер homestar hs 2004

Подпишитесь на новые товары в dopfo.ru